Review



xp 1 400 cell signaling technology 3579  (Cell Signaling Technology Inc)


Bioz Verified Symbol Cell Signaling Technology Inc is a verified supplier
Bioz Manufacturer Symbol Cell Signaling Technology Inc manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    Cell Signaling Technology Inc xp 1 400 cell signaling technology 3579
    Xp 1 400 Cell Signaling Technology 3579, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 942 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sox2+cell+signaling+technology+3579+rabbit/Sox2+XP+Rabbit+mAb/pm41792118-387-250-252
    Average 96 stars, based on 942 article reviews
    xp 1 400 cell signaling technology 3579 - by Bioz Stars, 2026-10
    96/100 stars

    Images

    Related Articles

    other:

    Article Title: LINC01137 facilitates pancreatic cancer stemness, chemoresistance and proliferation via the miR-7155-5p/KLF12/PI3K-Akt axis.
    Article Snippet: Pancreatic ductal adenocarcinoma (PDAC) is one of the most prevalent and malignant types of pancreatic cancer, with a 5-year survival rate of approximately 13%.. Cancer stem cells (CSCs) play pivotal roles in chemoresistance and recurrence.. Long non-coding RNAs (lncRNAs) have been identified as key regulators of the biological progression of various cancers.

    Immunohistochemistry:

    Article Title: LINC01137 facilitate pancreatic cancer stemness via the miR-7155-5p/KLF12/AKT axis
    Article Snippet: .. Species Dilution GAPDH Proteintech 60004-1-Ig Mouse 1:1000 p-AKT Cell Signaling Technology 4060 Rabbit 1:2000 CD44 Proteintech 60224-1-Ig Mouse 1:2000 Sox2 Cell Signaling Technology 3579 Rabbit 1:1000 Oct-4A Cell Signaling Technology 2840 Rabbit 1:1000 p-Rb Cell Signaling Technology 8516 Rabbit 1:1000 p21 Cell Signaling Technology 2947 Rabbit 1:1000 KLF12 Proteintech 13156-1-AP Rabbit 1:1000 ALDH1A1 Cell Signaling Technology 54135 Rabbit 1:1000 NANOG Cell Signaling Technology 4903 Rabbit 1:2000 Cyclin D3 Cell Signaling Technology 2936 Mouse 1:2000 CDK4 Cell Signaling Technology 12790 Rabbit 1:1000 AKT Cell Signaling Technology 4685 Rabbit 1:1000 Table 3 Primary antibodies for IHC Antibody Company Cat. No. .. Species Dilution CD133 Proteintech 18470-1-AP Rabbit 1:500 CD44 Proteintech 60224-1-Ig Mouse 1:500 PCNA Servicebio GB11010 Rabbit 1:500 Table 4 MiRNA mimics and inhibitor, shRNA, and NC sequences.

    Article Title: LINC01137 involvement in pancreatic cancer stemness via the miR-7155-5p/KLF12/AKT axis
    Article Snippet: .. Species Dilution GAPDH Proteintech 60004-1-Ig Mouse 1:1000 p-AKT Cell Signaling Technology 4060 Rabbit 1:2000 CD44 Proteintech 60224-1-Ig Mouse 1:2000 Sox2 Cell Signaling Technology 3579 Rabbit 1:1000 Oct-4A Cell Signaling Technology 2840 Rabbit 1:1000 p-Rb Cell Signaling Technology 8516 Rabbit 1:1000 p21 Cell Signaling Technology 2947 Rabbit 1:1000 KLF12 Proteintech 13156-1-AP Rabbit 1:1000 ALDH1A1 Cell Signaling Technology 54135 Rabbit 1:1000 NANOG Cell Signaling Technology 4903 Rabbit 1:2000 Cyclin D3 Cell Signaling Technology 2936 Mouse 1:2000 CDK4 Cell Signaling Technology 12790 Rabbit 1:1000 AKT Cell Signaling Technology 4685 Rabbit 1:1000 Table 3 Primary antibodies for IHC Antibody Company Cat. No. .. Species Dilution CD133 Proteintech 18470-1-AP Rabbit 1:500 CD44 Proteintech 60224-1-Ig Mouse 1:500 PCNA Servicebio GB11010 Rabbit 1:500 Page 19/30 Name Nucleotide sequence (5' to 3') hsa-miR-7155-5p inhibitor GAUGGCCCAAGACCCCAGA inhibitor NC UCUACUCUUUCUAGGAGGUUGUGA hsa-miR-7155-5p-mimics sense UCUGGGGUCUUGGGCCAUC hsa-miR-7155-5p-mimics antisense UGGCCCAAGACCCCAGAUU mimics NC sense UCACAACCUCCUAGAAAGAGUAGA mimics NC antisense UCUACUCUUUCUAGGAGGUUGUGA sh-LINC01137#1 sense GGGTGAGAACCTACTTCTTCA sh-LINC01137#1 antisense TGAAGAAGTAGGTTCTCACCC sh-LINC01137#2 sense GCATCATGCATGTAACTTTCA sh-LINC01137#2 antisense TGAAAGTTACATGCATGATGC sh-Control sense TTCTCCGAACGTGTCACGT sh-Control antisense ACGTGACACGTTCGGAGAA Figures Page 20/30 Figure 1 Higher LINC01137 expression in PCSCs was associated with poor outcome. a Heatmap showing the differential long intergenic lncRNAs between CSC-like and non-CSC-like cells whose data was obtained from GSE51971. b Relationship between LINC01137 and stemness-associated genes (CD44 and CD133) in TCGA and MTAB 6690. c Differential and d-e prognostic analyses of LINC01137 in the GEPIA database using data from TCGA. f The expression of LINC01137 in patients divided by cancer stages using Page 21/30 expression data from TCGA database (n=179). g LINC01137 expression in 72 pairs of PDAC tumor tissues and adjacent normal tissues. h Prognostic analysis of LINC01137 using clinical prognostic data of 72 patients from Ruijin Hospital, Shanghai. i LINC01137 expression in pancreatic cell lines. j Knockdown e ciency of LINC01137 in two pancreatic cell lines (CFPAC-1 and Panc-1).



    Similar Products

    96
    Cell Signaling Technology Inc xp 1 400 cell signaling technology 3579
    Xp 1 400 Cell Signaling Technology 3579, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sox2+cell+signaling+technology+3579+rabbit/Sox2+XP+Rabbit+mAb/pm41792118-387-250-252
    Average 96 stars, based on 1 article reviews
    xp 1 400 cell signaling technology 3579 - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    96
    Cell Signaling Technology Inc sox2 cell signaling technology 3579 rabbit
    Sox2 Cell Signaling Technology 3579 Rabbit, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sox2+cell+signaling+technology+3579+rabbit/Sox2+XP+Rabbit+mAb/pm41490917-400-9-10
    Average 96 stars, based on 1 article reviews
    sox2 cell signaling technology 3579 rabbit - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    96
    Cell Signaling Technology Inc rabbit anti sox2 cell signaling technology
    Rabbit Anti Sox2 Cell Signaling Technology, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sox2+cell+signaling+technology+3579+rabbit/Sox2+XP+Rabbit+mAb/pm41120788-261-92-94
    Average 96 stars, based on 1 article reviews
    rabbit anti sox2 cell signaling technology - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    96
    Cell Signaling Technology Inc sox2 3579s rabbit n a cell signaling technology
    Sox2 3579s Rabbit N A Cell Signaling Technology, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sox2+cell+signaling+technology+3579+rabbit/Sox2+XP+Rabbit+mAb/pmc12512320__13287_2025_4666_MOESM1_ESM-13-11-15
    Average 96 stars, based on 1 article reviews
    sox2 3579s rabbit n a cell signaling technology - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    96
    Cell Signaling Technology Inc oct4 cell signaling technology
    Oct4 Cell Signaling Technology, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sox2+cell+signaling+technology+3579+rabbit/Sox2+XP+Rabbit+mAb/pmc11834101__mmc2-239-19-20
    Average 96 stars, based on 1 article reviews
    oct4 cell signaling technology - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    96
    Cell Signaling Technology Inc triton x cell signaling technologies 3579s danvers
    Triton X Cell Signaling Technologies 3579s Danvers, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sox2+cell+signaling+technology+3579+rabbit/Sox2+XP+Rabbit+mAb/ppr0951182-509-184-186
    Average 96 stars, based on 1 article reviews
    triton x cell signaling technologies 3579s danvers - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    96
    Cell Signaling Technology Inc cell signaling technology 3579
    Cell Signaling Technology 3579, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sox2+cell+signaling+technology+3579+rabbit/Sox2+XP+Rabbit+mAb/pmc11620608-21-2-2
    Average 96 stars, based on 1 article reviews
    cell signaling technology 3579 - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    96
    Cell Signaling Technology Inc sox2 cell signaling technology 3579 ab 2195767 ihc
    Sox2 Cell Signaling Technology 3579 Ab 2195767 Ihc, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sox2+cell+signaling+technology+3579+rabbit/Sox2+XP+Rabbit+mAb/pm39636943-111-149-150
    Average 96 stars, based on 1 article reviews
    sox2 cell signaling technology 3579 ab 2195767 ihc - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    96
    Cell Signaling Technology Inc sox2 cell signalling technologies
    Figure 4. CAFs promote cell-state-specific reprogramming into a pro-invasive phenotype (A) Experimental design of scRNA-seq. (B) UMAP plot showing clustering of all cells analyzed by scRNA-seq. (C) Differential gene expression analysis in two patient-derived cell lines. Relevant differentially expressed genes (< 0.5 or >0.5 log2 fold change) are labeled. Note high expression of stem cell genes such as <t>SOX2</t> in UTSCC76 and high expression of EMT-related ECM genes and AREG in UTSCC74. (D) UMAP plot of cancer cells re-clustered without CAFs. Note separation of UTSCC74 clusters upon co-culture with CAFs. (E) Differential gene expression analysis of the SCC cells upon co-culture with CAFs compared with the same cells cultured alone. (F) GO terms enriched among genes upregulated in UTSCC74 cells co-cultured with CAFs compared with the same SCC cells cultured alone.
    Sox2 Cell Signalling Technologies, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sox2+cell+signaling+technology+3579+rabbit/Sox2+XP+Rabbit+mAb/pm39471809-272-143-144
    Average 96 stars, based on 1 article reviews
    sox2 cell signalling technologies - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    Image Search Results


    Figure 4. CAFs promote cell-state-specific reprogramming into a pro-invasive phenotype (A) Experimental design of scRNA-seq. (B) UMAP plot showing clustering of all cells analyzed by scRNA-seq. (C) Differential gene expression analysis in two patient-derived cell lines. Relevant differentially expressed genes (< 0.5 or >0.5 log2 fold change) are labeled. Note high expression of stem cell genes such as SOX2 in UTSCC76 and high expression of EMT-related ECM genes and AREG in UTSCC74. (D) UMAP plot of cancer cells re-clustered without CAFs. Note separation of UTSCC74 clusters upon co-culture with CAFs. (E) Differential gene expression analysis of the SCC cells upon co-culture with CAFs compared with the same cells cultured alone. (F) GO terms enriched among genes upregulated in UTSCC74 cells co-cultured with CAFs compared with the same SCC cells cultured alone.

    Journal: Cell

    Article Title: Multiparameter imaging reveals clinically relevant cancer cell-stroma interaction dynamics in head and neck cancer.

    doi: 10.1016/j.cell.2024.09.046

    Figure Lengend Snippet: Figure 4. CAFs promote cell-state-specific reprogramming into a pro-invasive phenotype (A) Experimental design of scRNA-seq. (B) UMAP plot showing clustering of all cells analyzed by scRNA-seq. (C) Differential gene expression analysis in two patient-derived cell lines. Relevant differentially expressed genes (< 0.5 or >0.5 log2 fold change) are labeled. Note high expression of stem cell genes such as SOX2 in UTSCC76 and high expression of EMT-related ECM genes and AREG in UTSCC74. (D) UMAP plot of cancer cells re-clustered without CAFs. Note separation of UTSCC74 clusters upon co-culture with CAFs. (E) Differential gene expression analysis of the SCC cells upon co-culture with CAFs compared with the same cells cultured alone. (F) GO terms enriched among genes upregulated in UTSCC74 cells co-cultured with CAFs compared with the same SCC cells cultured alone.

    Article Snippet: The remainingparameterswere formattedasa ‘‘count Antibody target Supplier and catalogue number Dilution, staining time and temperature AREG LSBio LS-B13911 1:100, 1h Room temperature (RT) aSMA Dako M0851 1:500, 2h RT ß-catenin Cell Marque 224M-14 1:500, 1.5h RT Bmi-1 Cell Signalling Technologies 6964 1:100, 1.5h RT CD11b Bio SB 6441 1:200, Overnight 4 C CD3 Invitrogen MA5-14482 1:750, Overnight 4 C CD34 Dako M716529-2 1:200, Overnight 4 C E-cadherin BD 610182 1:200, 2h RT EGFR Cell Signalling Technologies 4267 1:200, 2h RT Epcam Abcam 71916 1:500, 2h RT FAP Abcam 207178 1:1000, 2h RT Keratin 14 Progen GP-CK14 1:200, 2h RT Keratin 18/8 Cell Signalling Technologies 4546 1:50, 2h RT Myh9 Biolegend Poly 909801 1:2000, 1h RT Pan-cytokeratin Abcam 7753 1:150, 2h RT Pan-cytokeratin Invitrogen MA5-13156 1:100, 2h RT PDGFRB Cell Signalling Technologies 3169 1:100, 1.5h RT Slug Cell Signalling Technologies 9585 1:50, 1.5h RT Sox2 Cell Signalling Technologies 3579 1:100, 2h RT Tenascin C R&D MAB 2138 1:100, 1.5h RT Vimentin Santa Cruz Biotechnology SC6260 1:200, 2h RT Parameter Epithelial panel Stromal panel Nuclear mean intensity DAPI, Slug, Bmi1, Sox2 DAPI Cytoplasmic mean intensity ß-catenin, KRT8/18, KRT14, Epcam, Vimentin PDGFRB-ß, CD11b, CD34, CD3, a-SMA, FAP, Pan-cytokeratin, EGFR Morphometric parameters Area, circularity, roundness, perimeter, solidity, compactness, aspect ratio, EFC ratio Local neighborhood parameters Order, number of neighbors (nuclei within 85 pixels to each other in centroid-to-centroid distance), distance to nearest neighbor, distance to nearest epithelial/stromal cell ll OPEN ACCESS Cell 187, 1–18.e1–e9, December 12, 2024 e5 Please cite this article in press as: Punovuori et al., Multiparameter imaging reveals clinically relevant cancer cell-stroma interaction dynamics in head and neck cancer, Cell (2024), https://doi.org/10.1016/j.cell.2024.09.046 Article matrix’’ and analyzed using the Seurat package in R.53 All parameter values were normalized to remove sampling effect and scaled to obtain relative parameter expression between cells.

    Techniques: Gene Expression, Derivative Assay, Labeling, Expressing, Co-Culture Assay, Cell Culture